-
The temporal profile of activity-dependent presynaptic phospho-signalling rev...
Depolarization of presynaptic terminals stimulates calcium influx, which evokes neurotransmitter release and activates phosphorylation-based signalling. Here, we present the... -
Akt Activates NOS.
A) Western blot indicating that ISO increases Akt phosphorylation at S473 in a dose-dependent manner in isolated rabbit cells. B) ISO-dependent increase in p-Akt is blunted by... -
Additional file 9 of A novel PET tracer 18F-deoxy-thiamine: synthesis, metabo...
Additional file 9: Figure 3G. G: LC-MS result of cold standard sample of 18F-deoxy-thiamine, the purity has been highlighted. -
r37980778c78--0e1944e1d78f2f2981f65297ae1bbbc3
(A) Cells were kept as controls or treated with leptin for 1, 4, 8, and 24 h, and the phosphorylations of STAT3 and STAT5 were determined by Western blot. (B-C) Cells were... -
Common γ-chain cytokine signaling is required for macroautophagy induction du...
Macroautophagy is a cellular process that mediates degradation in the lysosome of cytoplasmic components including proteins and organelles. Previous studies have shown that... -
Air pollution-induced placental epigenetic alterations in early life: a candi...
Particulate matter (PM) exposure during in utero life may entail adverse health outcomes in later-life. Air pollution's adverse effects are known to alter gene expression... -
r37980778c78--b742ae1e651129347dfd26a8fddf30a0
Proteins identified by secretome analysis as most highly secreted for K14+ compared to K14− cells. -
Additional file 1: of Activation of GPR40 produces mechanical antiallodynia v...
Figure S1. Expression of GPR40 in the spinal dorsal horn of neuropathic rats induced by L5/L6 spinal nerve ligation. Frozen sections were obtained from spinal lumbar... -
<i>Drosophila</i> VAMP7 regulates Wingless intracellular trafficking
Drosophila Wingless (Wg) is a morphogen that determines cell fate during development. Previous studies have shown that endocytic pathways regulate Wg trafficking and signaling.... -
r37980778c78--837f4a3a3f7193c65ae96594b1128c3c
The terminator regions of eukaryotes encode functional elements in the 3′ untranslated region (3′-UTR) that influence the 3′-end processing of mRNA, mRNA stability, and... -
Supplemental Data 6
Query tree. Topology revealed by the all-sequences matrix constrained by the reference tree, using concatenated sequences of ETS, ITS and matK. Branches with support below 75%... -
Fluorescence anisotropy titration of purified recombinant AtMYB4 and AtMYB4Δ1...
Fluorescence anisotropy titration of purified recombinant AtMYB4 and AtMYB4Δ1 proteins using 5 μM 3’ fluorescein tagged oligos ( MYB4-Cis1flc:5’AACCTTCAACCAAACCCAAAT3’ and... -
PCR primers used in this study.
The underlines indicate the restriction enzyme sites introduced for ligation. *After cloning the γ-tubulin-mCherry fusion gene into the pyroA vector, the N-terminal region of... -
dedup_wf_001--c8c6e173e353c06fa7fe66885b52e316
(a) Four treatments included: A) a healthy tomato ‘receiver’ plant was connected with a neighboring Alternaria solani-challenged tomato ‘donor’ plant through common mycorrhizal... -
dedup_wf_001--7dc3f6163e6ca5f45d15949947218e44
Orthodontically Induced External Apical Root Resorption (OIEARR) dataset with genetic and non-genetic factors from a sample of 195 patients previously submitted to orthodontic... -
Additional file 1 of Mesenchymal stem cell-derived exosomal microRNA-136-5p i...
Additional file 1: Fig. S1. Identification of BMMSCs and exosomes. A: BMMSCs exhibiting a typical spindle-like morphology (100 ×). B: The pluripotent differentiation ability of... -
dedup_wf_001--71908dfa2ce1b1e70098db8e445f7b43
Additional file 1. The percentage of the gap area in sublingual gland of four groups. -
Patients characteristics.
Legend to Table 2 to 7B: The CTL epitopes that should be recognized according to the HLA alleles are defined using the HXB2 reference. The observed corresponding epitopes in the... -
Subject characteristics.
Values represent good to excellent coefficient of correlations (p<0.05 for all). Empty cells indicate moderate or low correlations (p>0.05). Abbreviations are the same as Table... -
New "Pyrene Box" Cages for Adaptive Guest Conformations
The possibility of controlling the compression extent and the coiling shape of the 1,12-diammoniumdodecane guest is shown by changing the dimensions of the internal space of the...
